USE OF AN AGENT

专利摘要:
agents, pharmaceutical composition, uses of an agent and, uses of a drug and uses of gst-tt [001] this invention relates to: a new use of gst-tt and gst-tt suppressing agents; an apoptosis-inducing agent that contains as active components a drug that suppresses gst-tt and a drug that suppresses autophagy; a medical composition containing said agent; and a method using said medical composition to treat diseases associated with abnormal apoptosis.
公开号:BR112013033072B1
申请号:R112013033072-4
申请日:2011-06-21
公开日:2021-04-13
发明作者:Yoshiro Niitsu；Hiroki Nishita
申请人:Nitto Denko Corporation；
IPC主号:

专利说明:

FIELD OF THE INVENTION
[001] The present invention relates to new uses of GST-π and its suppressing agent, a new apoptosis-inducing agent, a pharmaceutical composition containing the apoptosis-inducing agent and a new therapeutic method for a disease associated with abnormal apoptosis. BACKGROUND OF THE INVENTION
[002] Cancer is one of the most important and worrying diseases facing humanity and a huge amount of research effort is being made to treat it. Cancer is a disease in which cells grow uncontrollably due to gene mutation, epigenetic abnormality, etc. In relation to genetic abnormalities in cancer, a large number (eg, Futreal et al., Nat Rev Cancer 2004; 4 (3): 177-83, etc.) has been reported, and many are believed to be somehow associated with signal transduction related to cell proliferation, differentiation and survival. In addition, due to these genetic abnormalities, abnormalities in signal transduction occur in cells that consist of normal molecules, and this causes activation or inactivation of a specific signal cascade and can ultimately become a triggering factor for abnormal cell proliferation. Initial cancer treatment has focused on suppressing cell proliferation itself, but since this treatment also suppresses cell proliferation with physiologically normal proliferation, it has been accompanied by side effects such as hair loss, gastrointestinal dysfunction or bone marrow suppression. In order to reduce these side effects, the development of drugs for the treatment of cancer based on a new concept like molecularly targeted drugs that target specific cancer genetic abnormalities or abnormalities in signal transduction.
[003] As a cancer-specific genetic abnormality, the KRAS abnormality (homologous to the Kirsten V-Ki-ras2 rat sarcoma viral oncogene) is well known. KRAS is a low molecular weight GTP-binding protein (also called low molecular weight G protein) positioned downstream of a tyrosine kinase receptor such as EGFR or PDGFR, and is responsible for transferring a signal related to the proliferation or differentiation of these receptors for a MAPK cascade downstream. Normal KRAS is activated through Grb2 and SOS by activating tyrosine kinase from a ligand-activated receptor, and phosphoryl MAPK like Raf in order to direct the MAPK cascade, but mutated KRAS is constantly activated without stimulation by a receiver and continues to transmit a proliferation signal. It is believed that because of this, abnormal cell proliferation occurs.
[004] On the one hand, the expression of glutathione-S-transferase (GST), which is one of the enzymes that catalyzes the conjugation of glutathione, in particular GST-π (glutathione S-transferase pi, also called GSTP1), increases by several cancer cells, and it has been pointed out that there is a possibility that this is a factor for resistance to some anticancer agents. In fact, it is known that when the antisense DNA of GST-π or a GST-π inhibitor is produced to act on a cancer cell line that is overexpressing GST-π and exhibiting drug resistance, resistance to the drug is suppressed (Takahashi and Niitsu, Gan To Kagaku Ryoho. 1994; 21 (7): 945-51, Ban et al., Cancer Res. 1996; 56 (15): 3577-82, Nakajima et al., J Pharmacol Exp Ther. 2003; 306 (3): 861-9). In addition, in a recent report, when GST-π siRNA is produced to act on an androgen-independent prostate cancer cell line that is overexpressing GST-π, its proliferation and apoptosis is increased (Hokaiwado et al ., Carcinogenesis. 2008; 29 (6): 1134-8). In addition, it has been suggested that in human colorectal cancer, the KRAS mutation appears to induce overexpression of GST-π through the activation of AP-1 (Miyanishi et al., Gastroenterology. 2001; 121 (4): 865-74).
[005] However, until now there has been almost no clarification on the relationship between GST-π and cell proliferation or apoptosis, the molecular mechanism of GST-π and the role, etc., of GST-π in various types of transduction of intracellular signal. Intracellular signal transduction is very complicated; a molecule can influence the effect of a plurality of molecules, or conversely, a molecule can be influenced by a plurality of molecules, when the effect of a certain molecule is inhibited, another signal cascade can be activated, and an often expected effect cannot be obtained. Therefore, it is necessary to elucidate the complicated mechanism of cellular signal transduction to develop better molecularly targeted drugs, but only a very small part of the mechanism has been elucidated in many years of research, and more research effort is needed. BRIEF DESCRIPTION OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION
[006] It is an objective of the present invention to provide new uses of GST-π and a suppressing agent thereof, a composition to effectively induce apoptosis in cells, and a method of using it. MEANS TO SOLVE THE PROBLEMS
[007] While conducting intensive research to elucidate the molecular mechanism of GST-π, the present inventors found that when the expression of GST-π is inhibited, the activation of Raf-1, MEK and ERK is greatly inhibited, and in a way similar in the PI3K (Phosphoinositide 3-kinase) signal cascade, which is activated by activation of a G protein-coupled receptor or a tyrosine kinase receptor, suppression of signal transduction occurs, and they clarified that, although apoptosis is caused by inhibition of GST-π expression, autophagy is induced more quickly than apoptosis. As a result of further research, it was further discovered that by suppressing autophagy, in addition to inhibiting GST-π, cells can be induced to undergo apoptosis with high efficiency, and the present invention was thus accomplished.
[008] That is, the present invention relates to the following: (1) Agent for inducing apoptosis, whose agent contains as active ingredients a drug that suppresses GST-π and a drug that suppresses autophagy. (2) Agent for inducing apoptosis in a cell in which GST-π is suppressed, the agent of which contains an autophagy-suppressing drug as an active ingredient. (3) Agent, according to (1) or (2), whose agent is for inducing apoptosis in a cell that has mutated KRAS. (4) Agent, according to any one of (1) to (3) above, in which the active ingredient is selected from the group consisting of an RNAi molecule, a ribozyme, an antisense nucleic acid, a chimera polynucleotide of DNA / RNA, and a vector that expresses the same. (5) Pharmaceutical composition containing the agent according to any one of (1) to (4) above. (6) Pharmaceutical composition, according to (5) above, whose composition is for use in the treatment of a disease caused by abnormal cell proliferation. (7) Pharmaceutical composition, according to (5) above, whose composition is for use in the treatment of a disease caused by KRAS mutation. (8) Pharmaceutical composition, according to (5) above, whose composition is for use in the treatment of cancer. (9) Agent, to promote PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade, whose agent contains as an active ingredient GST-π and / or a functional variant thereof. (10) Agent, to suppress PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade, whose agent contains a drug that suppresses GST-π as an active ingredient. (11) Agent, to suppress ubiquitination, whose agent contains as an active ingredient GST-π and / or a functional variant thereof. (12) Agent, to promote ubiquitination, the agent of which contains a drug that suppresses GST-π as an active ingredient. (13) Agent, to suppress autophagy, whose agent contains as an active ingredient GST-π and / or a functional variant thereof. (14) Agent, to promote autophagy, whose agent contains a drug that suppresses GST-π as an active ingredient. EFFECTS OF THE INVENTION
[009] Since the agent that induces apoptosis of the present invention can induce apoptosis effectively compared to a conventional one, its effectiveness as a pharmaceutical composition is also high. In the treatment of cancer in particular, since cancer cells can be destroyed by apoptosis, not only is it possible to inhibit the cancer from progressing, but an effect on making the cancer regress can also be expected. In addition, since the same level of effect as that of a conventional formulation can be exhibited at a lower dose than that of the conventional one, it becomes possible to reduce side effects.
[010] Furthermore, according to the present invention, the molecular mechanism of GST-π has become clear and a new use of GST-π or a suppressing agent has been discovered. This provides new options for the treatment of disease, experimental techniques, etc., and a huge contribution can be expected not only for medicine and veterinary medicine, but also for the fields of biology, biochemistry, molecular biology, etc. BRIEF DESCRIPTION OF THE FIGURES
[011] Figure 1 a) is the result of western blotting showing a state in which GST-π expression is specifically suppressed by GST-π siRNA. Figure 1 b) is a diagram showing changes in the number of cells and level of GST-π expression on the 1st to the 4th day after transfection of GST-π siRNA.
[012] Figure 2 is the result of western blotting showing the protein expression state involved in the RAS / Raf / MAPK signal cascade on the second day after transfection of GST-π siRNA. It can be seen that, following the suppression of GST-π expression, the level of Raf protein expression decreases and, in addition, the phosphorylation of a MAPK such as MEK or ERK is suppressed.
[013] Figure 3 shows the result of an experiment in the immunoprecipitation of Raf protein. It can be seen that in a group treated with GST-π siRNA, the expression of Raf protein and phosphorylated Raf protein in Ser621 (p-Raf-1 (S621)) decreased slightly, while on the contrary, the ubiquitinated Raf protein increased.
[014] Figure 4 is a diagram comparing the abundance of Raf protein when the GST-π transfectant siRNA and mixture of transfectant siRNA were treated with proteasome inhibitor MG132 and DMSO, which was a negative control. It was observed that for GST-π transfectant siRNA, treatment with proteasome inhibitor increased the abundance of phosphorylated Raf protein (p-Raf-1 (S338)), but no changes were observed for siRNA mixing. That is, this suggests that due to suppression of GST-π expression, the phosphorylated Raf protein undergoes degradation by proteasome, and this is consistent with the increase in the Raf protein ubiquitinated in Figure 3.
[015] FIG. Figure 5 shows the results of an experiment on the co-immunoprecipitation of Raf and GST-π proteins. Due to a reaction towards the anti-GST-π antibody being shown for protein precipitated by anti-p-Raf-1 antibody, it is suggested that p-Raf-1 and GST-π form a complex.
[016] Figure 6 shows immunofluorescence staining images of GST-π knockdown cells. The upper lines are images stained with anti-LC3 antibody and the lower lines are images stained with DAPI. From the left at the top are colored images of the 1st day, 2nd day and 3rd day after the transfection, and from the left at the bottom of the 4th day and the 5th day after the transfection, respectively. In the cells marked by arrows in the figure, a spot signal was observed that can be considered to be an autophagosome, inferring that autophagy is induced.
[017] Figure 7 shows electron microscopy images of GST-π knockdown cells at the time point when 2 days had elapsed after transfection of GST-π siRNA. In the figure on the left, N denotes the nucleus, and the figure on the right is an enlarged image of part A surrounded by the square. In the figure on the right, M denotes mitochondria and L denotes lysosome. It was observed that autophagosomes were formed to surround the mitochondria in the areas shown by arrows.
[018] Figure 8 shows the results of western blotting of a GST-π knockdown cell extract with the use of anti-LC3 antibody. It was observed that in KD cells in GST-π (GST-π siRNA), the expression of LC3 markedly increased compared to the control (mixture of siRNA). Since LC3 type II (LC3-II), in particular, has increased a lot, this infers the induction of autophagosome.
[019] Figure 9 shows the results of TUNEL staining. The top line shows images of a control group and the bottom line shows images of a group of KD cells in GST-π. Shows from the left, colored images of the 3rd day, 4th day and 5th day after transfection. In the group of KD cells in GST-π, TUNEL positive cells were observed.
[020] Figure 10 is a graph (top) showing change over time in the proportions of cells positive for autophagy and cells positive for apoptosis in a group of KD cells in GST-π, and a group of control cells in point in time when 1 to 4 days had passed after siRNA transfection, and a diagram (bottom) showing the level of GST-π expression in KD cells in GST-π. It shows that in the control group hardly any autophagy or apoptosis was observed, whereas in the KD group of GST-π autophagy positive cells first rapidly increased with a peak on the 2nd day, and then apoptosis was induced.
[021] Figure 11 shows the results of western blotting of protein involved in EGFR / PI3K / Akt / mTOR signaling in KD cells in GST-π. It can be seen that in a group of KD cells of GST-π, the phosphorylation of EGFR, PI3K and Akt was notably suppressed.
[022] Figure 12 shows the results of western blotting showing changes in the expression of phosphorylated EGFR (p-EGFR) when KD cells in GST-π were treated with MG132 proteasome inhibitor. Since a reduction in the level of expression of p-EGFR in KD cells in GST-π was recovered by treatment with a proteasome inhibitor, it was inferred that the reduction in expression of p-EGFR was due to degradation by proteasome.
[023] Figure 13 shows the result of co-immunoprecipitated western blotting with the use of anti-p-EGFR. Since a signal was observed for anti-GST-π antibody, it was inferred that p-EGFR and GST-π interacted with each other.
[024] Figure 14 shows the results when examining the change in the level of Raf and EGFR protein expression depending on the inhibitor concentration when the G16-π C16C2 inhibitor was used. It was observed that, as in the case of GST-π knockdown, phosphorylation of EGFR or Raf protein was also suppressed when the GST-π inhibitor was used.
[025] Figure 15 is a graph showing changes in the number of cells when the C16C2 inhibitor of GST-π was added. It can be seen that when the GST-π inhibitor was added, there was hardly any increase in the number of cells.
[026] Figure 16 is a graph showing the proportion of cells positive for autophagy in a group treated with a mixture of siRNA, a KD group in GST-π, and a KD in GST-π + 3MA group. It can be seen that the autophagy that was increased by GST-π knockdown was suppressed by 3-MA.
[027] Figure 17 shows images stained with TUNEL when 3-MA was added to KD cells in GST-π. The top line is a case where 3-MA has been added to 1 mM, and the bottom line is a case where 3-MA has been added to 5 mM. Shows from the left, stained images of the 2nd day, 3rd day and 4th day after transfection. The greater the amount of 3-MA added, the more apoptotic cells were observed.
[028] Figure 18 is a graph showing the results when the percentage of apoptosis was examined over time in a group of control cells (siRNA mixture), a group of KD cells in GST-π (GST- siRNA) π), a KD cell in GST-π + group 1 mM of 3-MA (siRNA of GST-π + 1 mM of 3-MA), and a KD cell in GST-π + group of 5 mM of 3-MA (GST-π + 5 mM 3-MA siRNA). It was found that there was an additional induction of dose-dependent apoptosis of 3-MA. MODES FOR CARRYING OUT THE INVENTION
[029] The present invention relates to an agent or composition to induce apoptosis (hereinafter also referred to as an “apoptosis-inducing agent” or an “apoptosis-inducing composition”) which contains as a active ingredient a drug which suppresses GST-π and a drug that suppresses autophagy.
[030] When used in the present application, GST-π denotes an enzyme, encoded by the GSTP1 gene, which catalyzes the conjugation of glutathione. GST-π is present in several animals, including humans, and its sequence information is known (for example, human: NP_000843 (NM_000852), rat: NP_036709 (NM_012577), mouse: NP_038569 (NM_013541), etc. The numbers denote the access numbers in the NCBI database, outer parentheses are amino acid sequence numbers, and inner parentheses are base sequence numbers).
[031] Since there is a possibility of a mutation of a gene sequence or an amino acid sequence between biological individuals, which do not compromise the physiological function of a protein, the GST-π and GSTP1 genes in the present invention are not limited to a protein or nucleic acid that have the same sequence as the sequences known above, and may include those that have a sequence that is different from the above sequence by one or more amino acids or bases, typically one or some, for example, one, two , three, four, five, six, seven, eight, nine, or ten amino acids or bases, but have a function equivalent to that of the known GST-π. The specific function of GST-π is as described later.
[032] In this specification, phrases such as "when used in this application", "used in this application", "in this specification" and "described in this application" mean, unless otherwise specified, that the The following description applies to all inventions described in this specification. In addition, unless otherwise stated, all technical terms and scientific terms used in this application have the same meaning as that usually understood by a person skilled in the art. The entirety of all patents, patent publications and other publications referred to in this application are incorporated into this application as a reference.
[033] Examples of the “drug that suppresses GST-π” used in this application include, but are not limited to, a drug that suppresses the production and / or activity of GST-π and a drug that promotes degradation and / or inactivation of GST-π. Examples of the drug that suppresses GST-π production include, but are not limited to, an RNAi molecule, ribozyme, antisense nucleic acid, or DNA / RNA chimeric DNA polynucleotide encoding GST-π, or an expression vector the same.
[034] Examples of the drug that suppresses GST-π activity include, but are not limited to, a substance that binds GST-π such as, for example, glutathione, a glutathione analog (for example, those described in WO 95 / 08563, WO 96/40205, WO 99/54346, Nakajima et al., 2003, above, etc.), ketoprofen (Takahashi and Niitsu, 1994 above), indomethacin (Hall et al., Cancer Res. 1989; 49 ( 22): 6265-8), ethacrynic acid, Piloprost (Tew et al., Cancer Res. 1988; 48 (13): 3622-5), an anti-GST-π antibody, and a dominant negative mutant of GST-π . These drugs are both commercially available and can be produced appropriately based on known techniques.
[035] The drug that suppresses the production or activity of GST-π is preferably an RNAi molecule, ribozyme, antisense nucleic acid, or DNA / RNA chimera polynucleotide for DNA encoding GST-π, or an expression vector of the same , in terms of high specificity and a low possibility of side effects.
[036] GST-π suppression can be determined by the expression or activity of GST-π in cells being suppressed, compared to a case where a GST-π suppression agent is not used. GST-π expression can be assessed by any known technique; examples of it include, but are not limited to, an immunoprecipitation method that uses an anti-GST-π antibody, EIA, ELISA, IRA, IRMA, a western blot method, an immunohistochemistry method, a cytometry method flow, various hybridization methods that use a nucleic acid that specifically hybridizes to a nucleic acid encoding GST-π or a single fragment thereof, or a transcription product (eg mRNA) a splicing product of said nucleic acid , a northern blot method, a Southern blot method, and several PCR methods.
[037] In addition, GST-π activity can be assessed by analyzing a known GST-π activity including, but not limited to, binding to a protein such as Raf-1 (in particular Raf- 1 phosphorylated) or EGFR (in particular, phosphorylated EGFR) by any method known as, for example, an immunoprecipitation method, a western blot method, a mass analysis method, a pull-down method, or a surface plasmon resonance (SPR).
[038] When used in the present application, the RNAi molecule denotes any molecule that causes RNA interference, including, but not limited to, a duplex RNA such as siRNA (small interfering RNA), miRNA (micro RNA), shRNA ( Short clamp RNA), ddRNA (RNA directed to DNA), piRNA (RNA that interacts with Piwi), or rasiRNA (siRNA associated with repetition) and modified forms thereof. These RNAi molecules can be commercially available or they can be designed and prepared based on information of known sequence, etc.
[039] In addition, when used in the present application, the antisense nucleic acid includes RNA, DNA, PNA, or a complex thereof.
[040] When used in the present application, the DNA / RNA chimera polynucleotide includes, but is not limited to, a double-stranded polynucleotide composed of DNA and RNA that inhibits the expression of a target gene described, for example, in JP, A , 2003-219893.
[041] When used in the present application, autophagy may include macroautophagy, chaperone-mediated autophagy, etc., but it typically means macroautophagy. Therefore, the term "autophagy" in the present invention refers to "macroautophagy" unless otherwise specified.
[042] Autophagy, which means "self-destruction", is one of the intracellular mechanisms of protein degradation, and is responsible for the degradation and recycling of protein within a cell. Autophagy is observed in a wide variety of biological species including yeasts and mammals, and is usually accompanied by a series of processes including the formation of a PAS (phagophore assembly site), (b) elongation and extension of the phagophore that surrounds a protein to be degraded (isolation membrane) and formation of an autophagosome that encapsulates the protein to be degraded, (c) formation of an autolysome by fusion of an autophagosome and a lysosol, and (d) degradation of the protein within the autolysome.
[043] The processes (a) to (c) above involve specific factors related to autophagy. With reference to factors related to autophagy, the first survey was conducted with yeast, and a large number, including ATG1 to ATG27, has been identified so far (Klionsky et al., Dev Cell. 2003; 5 (4): 539-45) ; mammal research has also advanced, a plurality of counterparts have been identified, and the main molecular mechanism of autophagy is becoming clear (Yang and Klionsky, Curr Opin Cell Biol. 2010; 22 (2): 124-31).
[044] Examples of factors related to autophagy involved in the main molecular mechanism of autophagy in mammals include those involved in the formation of PAS, such as VMP1, TP53INP2, mAtg9, the ULK complex (compounds of ULK1, ULK2, mAtg13 and FIP200), the complex PI3K (the Atg14L complex composed of Beclin1, hVps34, p150, Ambra1 and Atg14L, and the UVRAG complex composed of Beclin1, hVps34, p150, Bif-1 and UVRAG) and those involved in phage phosphorus elongation such as LC3-II and the Atg12 complex -Atg5-Atg16L.
[045] Therefore, examples of the drug that suppresses autophagy include, but are not limited to, a drug that suppresses the production and / or activity of a factor related to autophagy such as those described above and a drug to promote degradation and / or inactivation of a factor related to autophagy. Examples of the drug that suppresses the production of a factor related to autophagy include an RNAi molecule, ribozyme, antisense nucleic acid, or DNA / RNA chimera polynucleotide for DNA that encodes a factor related to autophagy, or an expression vector thereof.
[046] Examples of the drug that suppresses the activity of a factor related to autophagy include, but are not limited to, a PI3K inhibitor (eg, wortmannin, etc.), in particular a class III PI3K inhibitor (eg, 3-MA (3-methyladenine), etc.), a substance that inhibits the fusion of an autophagosome and a lysosome (for example, bafilomycin A1, etc.), a substance that inhibits protein degradation in an autolisosome (for example , chloroquine, leupeptin, etc.), a substance that binds to a factor related to autophagy (for example, an antibody to a factor related to autophagy, etc.), and a dominant negative mutant to a factor related to autophagy. These drugs are either commercially available or can be produced appropriately based on known techniques. In an embodiment of the present invention, the autophagy-suppressing drug does not contain GST-π and / or a functional variant thereof.
[047] From the point of view of high specificity and low side effects, the drug that suppresses autophagy is preferably an RNAi molecule, ribozyme, antisense nucleic acid, or a DNA / RNA chimera polynucleotide for DNA that encodes a factor related to autophagy , or a vector that expresses the same.
[048] Autophagy suppression can be determined by observing that autophagy is suppressed in cells, compared to a case in which the autophagy suppression agent of the present invention is not used. Inhibition of autophagy can be assessed based on any known technique, examples of which include, but are not limited to, detection of an autophagosome by an electron microscopy method, and detection of an autophagy marker (eg Atg5, Atg12, LC3, in particular LC3-II, etc.). LC3-II can be detected, for example, but not limited to the use of an antibody specific to LC3-II, or it can be detected by subjecting a sample to electrophoresis separation, etc., and then detecting LC3-II, separated as a band that is different from LC3-I, by a western blot method, etc., with the use of an antibody that reacts with LC3-II or both, LC3-I and LC3-II. In addition, due to the fact that LC3-I is dispersed within the cytoplasm, although LC3-II is located in a specific autophagy structure such as an isolation membrane, an autophagosome or an autolysome, the presence or number of signs similar to spots showing these structures, which are manifested by immunostaining, etc., with an antibody that reacts with LC3-II (including an antibody that reacts with both, LC3-I and LC3-II) can be used as an indicator for autophagy.
[049] The drug that suppresses GST-π and the drug that suppresses autophagy may be contained in a single formulation or may be contained separately in two or more formulations. In the case of the latter, each formulation can be administered at the same time or they can be administered with a time interval between them. When administered with a time interval between them, the formulation containing a drug that suppresses GST-π can be administered before the formulation containing a drug that suppresses autophagy or can be administered thereafter.
[050] The present invention also relates to an agent or composition to induce apoptosis (hereinafter also called an “apoptosis inducing agent” or an “apoptosis inducing composition”) in cells where GST-π is suppressed, whose agent or composition contains as an active ingredient a drug that suppresses autophagy.
[051] When used in the present application, “GST-π being suppressed” includes, for example, a state in which GST-π is being suppressed in cells that express GST-π. Examples of this state include a state in which a drug that suppresses GST-π (for example, those described above, etc.) has been administered to cells that express GST-π.
[052] Whether or not GST-π is expressed in certain cells is known from the literature or can actually be determined by detecting GST-π expression in cells. GST-π expression can be detected by any known technique, including those described above.
[053] The agent or composition of the present invention can be that to induce apoptosis in cells that have mutated KRAS.
[054] When used in the present application, examples of mutated KRAS include, but are not limited to, those that have a mutation that causes constant activation of KRAS, such as a mutation that inhibits endogenous GTPase or a mutation that increases the guanine nucleotide exchange rate . Specific examples of such a mutation include, but are not limited to, for example, mutation at amino acids 12, 13 and / or 61 in human KRAS (inhibition of endogenous GTPase) and mutation at amino acids 116 and / or 119 in human KRAS (increasing the rate guanine nucleotide exchange) (Bos, Cancer Res. 1989; 49 (17): 4682-9, Levi et al., Cancer Res. 1991; 51 (13): 3497-502). Therefore, in an embodiment of the present invention, mutated KRAS can be a KRAS that has a mutation in at least one of amino acids 12, 13, 61, 116 and 119 of human KRAS. In one embodiment of the present invention, mutated KRAS has a mutation at amino acid 12 of human KRAS. In addition, in an embodiment of the present invention, mutated KRAS can be one that induces overexpression of GST-π. Therefore, cells that have mutated KRAS may exhibit overexpression of GST-π.
[055] Detection of mutated KRAS can be performed using any known technique. Examples of this technique include, but are not limited to, selective hybridization by means of a nucleic acid probe specific to a known mutation sequence, an incompatible enzyme cleavage method, sequencing (Bos, 1989 above), and a PCR method -RFLP (Miyanishi et al., 2001 above).
[056] In addition, the detection of GST-π expression can be performed using any known technique, including those described above. Whether or not GST-π is being overexpressed can be assessed, for example, by comparing the degree of GST-π expression in cells that have mutated KRAS with the degree of GST-πi expression in the same cell type that has normal KRAS . In this case, it can be said that GST-π is being overexpressed if the degree of GST-π expression in cells that have mutated KRAS exceeds the degree of GST-π expression in the same cell type that has normal KRAS.
[057] The amount of active ingredient formulated in the agent or composition of the present invention can be an amount that induces apoptosis when the agent or composition is administered. In addition, it is preferably an amount that does not cause an adverse effect that exceeds the administration benefit. This amount is known or can be determined appropriately by an in vitro test using cultured cells, etc., or a test on an animal model such as a mouse, a rat, a dog or a pig, and these test methods are well known to a person skilled in the art. The induction of apoptosis can be evaluated by several known techniques, for example, by detecting a specific phenomenon of apoptosis such as DNA fragmentation, attachment of annexin V to the cell membrane, alteration in the mitochondrial membrane potential or activation of caspase, or by staining TUNNEL. The amount of formulated active ingredient can vary according to the way in which the agent or composition is administered. For example, when a plurality of units of the composition are used for an administration, the amount of active ingredient to be formulated in one unit of the composition can be determined by dividing the amount of active ingredient required for an administration by said plurality of units. The adjustment of this amount of formulation can be performed properly by a technician in the subject.
[058] The present invention also relates to a process for producing an agent or composition to induce apoptosis, the process of which comprises formulating as active ingredients a drug that suppresses GST-π and a drug that suppresses autophagy; use of a drug that suppresses GST-π and a drug that suppresses autophagy in the production of an agent or composition to induce apoptosis; a combination of a drug that suppresses GST-π and a drug that suppresses autophagy for use in inducing apoptosis; and a method of inducing apoptosis that comprises administering effective amounts of drugs that suppress GST-π and drugs that suppress autophagy.
[059] The present invention also relates to a process for producing an agent or composition to induce apoptosis in cells in which GST-π is suppressed, the process of which comprises formulating as an active ingredient a drug that suppresses autophagy; use of a drug that suppresses autophagy in the production of an agent or composition to induce apoptosis in cells in which GST-π is suppressed; a drug that suppresses autophagy for use in inducing apoptosis in cells in which GST-π is suppressed; and a method of inducing apoptosis in cells in which GST-π is suppressed, the method of which is to administer an effective amount of a drug that suppresses autophagy.
[060] The amount of the drug or its formulation in the aforementioned production process or use is as described above. The formulation of each drug can be carried out according to any known technique.
[061] All of the above methods for inducing apoptosis can be either an in vitro method or an in vivo method. In addition, the drugs in the methods as described above, and the effective amount of the drug can be an amount that induces apoptosis in cells in which it is administered. It is also preferably an amount that does not cause an adverse effect that exceeds the benefit of administration. This amount is known or can be determined appropriately by an in vitro test using cultured cells, etc., and this test method is well known to a person skilled in the art. The induction of apoptosis can be evaluated by several known techniques, including those described above. The effective amount above does not necessarily need to be that which induces apoptosis in all cells of a cell population in which the drug is administered. For example, the effective amount above may be an amount that induces apoptosis in the cell population in at least 1% of the cells, at least 2%, at least 3%, at least 4%, at least 5%, at least 6% , at least 8%, at least 10%, at least 12%, at least 15%, at least 20%, at least 25%, etc.
[062] The apoptosis-inducing agent of the present invention can induce apoptosis effectively even in cells that have an abnormality in cell proliferation, etc., and is effective as a component of a pharmaceutical composition. Therefore, an aspect of the present invention includes a pharmaceutical composition that contains the apoptosis-inducing agent of the present invention.
[063] The pharmaceutical composition of the present invention is effective in the treatment of a disease in which there is abnormal apoptosis, in particular. Therefore, an embodiment of the present invention relates to a pharmaceutical composition for the treatment of a disease in which there is abnormal apoptosis, the pharmaceutical composition of which contains the apoptosis-inducing agent. When used in the present application, examples of the disease in which there is abnormal apoptosis include, but are not limited to, a disease due to abnormal cell proliferation, a disease due to KRAS mutation, and a disease due to overexpression of GST-π. Examples of the disease due to abnormal cell proliferation include, but are not limited to, a benign or malignant tumor, hyperplasia, keloid, Cushing's syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus and lentiginosis. Examples of the disease due to the KRAS mutation include, but are not limited to, a benign or malignant tumor (also called a cancer or malignant neoplasm). Examples of the disease due to overexpression of GST-π include, but are not limited to, a benign or malignant tumor, in particular a drug-resistant malignant tumor (for example, resistant to an alkylating agent such as melphalan or cyclophosphamide, an anti-tumor antibiotic) anthracycline base such as adriamycin, a platinum complex such as cisplatin, etoposide, etc.). In an embodiment of the present invention, the disease in which there is abnormal apoptosis is cancer.
[064] Examples of cancer in the present invention include, but are not limited to, sarcomas such as fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, angiosarcoma, Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, osteosarcoma, osteosarcoma, chondrosarcoma and osteosarcoma in the brain, head and neck carcinoma, breast carcinoma, lung carcinoma, esophageal carcinoma, gastric carcinoma, duodenum carcinoma, appendix carcinoma, colon carcinoma, rectal carcinoma, liver carcinoma, pancreatic carcinoma, gallbladder carcinoma, bile duct carcinoma, anal carcinoma, renal carcinoma, ureter carcinoma, bladder carcinoma, prostate carcinoma, penile carcinoma, testicular carcinoma, uterine carcinoma, ovarian carcinoma, vulva carcinoma, vaginal carcinoma and skin carcinoma and beyond addition, leukemia and malignant lymphoma. In the present invention, "cancer" includes epithelial and non-epithelial malignancy. The cancer in the present invention can be present anywhere on the body, for example, brain, head and neck, chest, limbs, lung, heart, thymus, esophagus, stomach, small intestine (duodenum, jejunum, ileum), large intestine ( colon, cecum, appendix, rectum), liver, pancreas, gallbladder, anus, kidney, urinary tract, bladder, prostate, penis, testis, uterus, ovary, vulva, vagina, skin, striated muscle, smooth muscle, synovial membrane, cartilage, bone, thyroid, adrenal gland, peritoneum, mesentery, bone marrow, blood, vascular system, lymphatic system such as lymph node, lymph fluid, etc.
[065] In one embodiment of the present invention, cancer includes cancer cells that have mutated KRAS defined above. In one embodiment of the present invention, cancer includes cancer cells that exhibit hormone or growth factor independent proliferation. In one embodiment of the present invention, cancer includes cancer cells that exhibit overexpression of GST-π. In one embodiment of the present invention, cancer is resistant to the drug. In one embodiment of the present invention, cancer has resistance to a drug selected from the group consisting of an alkylating agent such as melphalan or cyclophosphamide, an anthracycline-based antitumor antibiotic such as adriamycin, a platinum complex such as cisplatin and etoposide. In one embodiment of the present invention, cancer has resistance to a medicinal agent selected from the group consisting of melphalan, cyclophosphamide, adriamycin, cisplatin and etoposide.
[066] The present invention also relates to a pharmaceutical composition for the treatment of a disease in which there is abnormal apoptosis, the composition of which contains as active ingredients a drug that suppresses GST-π and a drug that suppresses autophagy, a process for producing a pharmaceutical composition for the treatment of a disease in which there is abnormal apoptosis, the process of which consists of formulating as active ingredients a drug that suppresses GST-π and a drug that suppresses autophagy; use of a drug that suppresses GST-π and a drug that suppresses autophagy for the production of a pharmaceutical composition for the treatment of a disease in which there is abnormal apoptosis, a combination of a drug that suppresses GST-π and a drug that suppresses autophagy for use in the treatment of a disease in which there is abnormal apoptosis, and a method for the treatment of a disease in which there is abnormal apoptosis, the method of which is to administer an effective amount of the pharmaceutical composition to a subject who needs it.
[067] The drug, the amount of formulation, and the disease in which there is abnormal apoptosis in the process of production or use are as described above. The formulation of each drug can be carried out according to any known technique.
[068] The present inventors have now clarified that GST-π binds to a tyrosine kinase receptor, which is upstream of the PI3K / AKT / mTOR signal cascade, in particular to its phosphorylated form, and to Raf, which is a constituent molecule of the RAS / Raf / MAPK signal cascade, in particular to its phosphorylated form, to inhibit the ubiquitination of these molecules, thereby promoting these signal cascades. Therefore, the present invention also relates to an agent or composition for promoting the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade (also called a "signal cascade promoter" or a “composition that promotes signal cascade”), whose agent or composition contains as an active ingredient GST-π and / or a functional variant thereof. In particular, the agent or composition of the present invention can promote both the PI3K / Akt / mTOR signal cascade and the RAS / Raf / MAPK signal cascade at the same time.
[069] Examples of the "functional variant of GST-π" used in the present application include, but are not limited to, (i) a variant that has one or more mutations, typically one or a few, in the amino acid sequence of GST-π , but still has a function equivalent to GST-π, (ii) a variant that is encoded by a nucleic acid that has a base sequence of a gene that encodes GST-π or a nucleic acid that has one or more mutations, typically one or a few, following a nucleic acid that encodes the same polypeptide as that encoded by the above nucleic acid, and has a function equivalent to GST-π, (iii) a variant that is encoded by a nucleic acid that hybridizes, subject to conditions stringent, to a complementary strand of a nucleic acid that has a base sequence of a gene encoding GST-π, a nucleic acid encoding the same polypeptide as that encoded by the above nucleic acid, or a nucleic acid encoding a variant of (ii), or a fragment of the complementary strand, and has a function equivalent to GST-π, (iv) a variant that has an amino acid sequence that has at least 60% homology, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, and particularly preferred at least 95% with the amino acid sequence of GST-π, and has a function equivalent to GST-π, and (v) a variant that is encoded by a nucleic acid that has at least homology at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, and particularly preferably at least 95% with the amino acid sequence of GST-π, and has a function equivalent to GST- π.
[070] The amino acid sequence of GST-π and the base sequence of the gene encoding GST-π are known for various types of animals as described above, and a person skilled in the art can adequately prepare the functional variants mentioned above based on these sequence information by any known technique, for example, chemical synthesis, cleavage or insertion of a nucleic acid by a restriction enzyme, site-directed mutagenesis, application of radiation or UV rays, etc.
[071] Whether or not a given variant has a function equivalent to GST-π can be assessed by analyzing a known function of GST-π including, for example, but not limited to, binding with a protein like Raf-1 (in phosphotylated Raf-1) or EGFR (in particular phosphorylated EGFR) by any method known, for example, an immunoprecipitation method, a western blot method, a mass analysis method, a pull-down method, or a surface plasmon resonance (SPR) method, and comparing it with an appropriate negative control or GST-π as a positive control. For example, when the function of a given variant is greater than a negative control, for example, when it is greater than at least 10%, at least 25%, at least 50%, at least 75%, or at least 100% and / or when the function is at least 1/100 of GST-π, at least 1/50, at least 1/25, at least 1/10, at least 1/5 or at least 1/2, this variant is included in the functional variants of GST-π.
[072] The term “stringent conditions” used in the present application is a known parameter in this technical field and is described in a standard protocol such as, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press (2001) or Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992).
[073] The stringent conditions in the present invention mean, for example, hybridization at 65 ° C by means of a hybridization buffer containing 3.5x SSC (0.15 M sodium chloride / 0.15 M sodium citrate, pH 7), Ficoll 0.02%, polyvinylpyrrolidone 0.02%, bovine serum albumin 0.02%, NaH2PO4 25 mM (pH 7), SDS 0.05%, and EDTA 2 mM. After hybridization, a membrane to which the DNA has been transferred is washed with 2x SSC at room temperature, and then with 0.1 to 0.5x SSC / 0.1x SDS at a temperature up to 68 ° C. Alternatively, stringent hybridization can be performed with the use of a commercial hybridization buffer, such as ExpressHyb® Hybridization Solution (Clontech) through hybridization and washing conditions described by the manufacturer.
[074] There are other applicable conditions, reagents, etc., which may result in the same degree of stringency, but since a person skilled in the art can be expected to be familiar with these conditions, they are not specifically mentioned in the present application. However, it is possible to manipulate conditions to clearly identify a nucleic acid that encodes a variant GST-π.
[075] GST-π and / or a functional variant thereof in the present invention includes, in addition to GST-π and a functional variant of the same as proteins, a nucleic acid encoding GST-π and a nucleic acid encoding a functional variant of GST-π.
[076] When used in the present application, the "signal cascade" means signal transduction in which a plurality of signaling molecules transmit a signal in the sequence. For example, in the case of the “PI3K / Akt / mTOR signal cascade”, a signal is transmitted so that PI3K is first activated, this then causes Akt to be activated, and this then causes mTOR to be activated. This also applies to the note of other signal cascades. With regard to the relationship between upstream and downstream signaling, the activation chain can be caused either directly or indirectly. For example, it is known that the activation of Akt caused by PI3K is mediated by molecules such as PIP3 (phosphatidylinositol (3,4,5) triphosphate) and PDK1 (phosphoinositide-dependent protein kinase 1, also called PDPK1).
[077] The PI3K / Akt / mTOR signal cascade is a signal cascade that is driven by PI3K activation and is known to be signaling involved in cell survival, etc. Examples of the way in which PI3K activation occurs include, but are not limited to, a ligand that binds to a coupled protein G receptor or tyrosine kinase receptor, and activated PI3K phosphorylates phospholipids inositol, thereby producing a phosphatidylinositol such as PIP3. It binds to PDK1 or Akt in a PH domain, thus promoting the location of these proteins in the membrane. PDK1 binds to PIP3 to thus be activated in the membrane, and the activated PDK1 phosphoryl T at position 308a Akt position. Serine at Akt's 473rd position is phosphorylated by mTORC2, which is one of the mTOR complexes, and Akt is fully activated as a result of phosphorylation of amino acids at these two positions.
[078] Although the route to Akt activation of mTOR has not been fully elucidated, it is believed that PRAS40 (Akt rich in proline / 40 kDa PKB substrate) is involved. PRAS40 is an Akt substrate as the name implies, and it is believed that it is a molecule that binds to a mTOR complex to then suppress its activation, and it is believed that when Akt is activated, PRAS40 is phosphorylated, thereby doing with that PRAS40 is released from the mTOR complex to activate mTOR. When mTOR is activated, ULK1 and ULK2 (kinase similar to unc-51) and mAtg13 (related to autophagy in mammals) are phosphorylated, thereby inhibiting the initiation of autophagy signaling to suppress autophagy.
[079] On the other hand, the RAS / Raf / MAPK signal cascade is a signal cascade that is related to cell proliferation, etc. When a ligand such as a growth factor that binds to a G protein-coupled receptor or a tyrosine kinase receptor, KRAS, which is a low molecular weight G protein, is activated, and activated KRAS phosphorylates Raf ( MAPKKK type) to activate it. Activated Raf activates MEK (MAPK / ERK kinase, a type of MAP2K), and activated MEK activates ERK (extracellular signal-regulated kinase, a type of MAPK). The activated ERK translocates in the nucleus and promotes transcription of several mRNAs to trigger cell proliferation.
[080] In the present invention, promoting a signal cascade means not only increasing the activation of the signal cascade, but also suppression of inactivation of the signal cascade. Whether or not a signal cascade is promoted can be determined by the signal cascade being activated, compared to a case where the agent or composition of the present invention is not used. The activation of a signal cascade can be assessed by detecting, for example, but not limited to, a cellular phenomenon resulting from the activation of a molecule that constitutes the signal cascade (for example, phosphorylation, etc.) or activation of a cascade signal, for example, suppression of autophagy, etc., in the case of the PI3K / Akt / mTOR signal cascade.
[081] The present invention also relates to a process for producing an agent or composition to promote the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade, the process of which comprises a formulation step GST-π and / or a functional variant thereof; use of GST-π and / or a functional variant thereof in the production of an agent or composition to promote the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade; GST-π and / or a functional variant thereof for use in promoting the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade; whose method comprises administering an effective amount of GST-π and / or a functional variant thereof.
[082] The agent or composition for promoting a signal cascade of the present invention is useful for the treatment of a disease associated with an abnormality of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / signal cascade / MAPK, in particular, with a suppression of these signal cascades. Examples of such a disease include, but are not limited to, a disease accompanied by suppression of expression or activity and / or increased degradation or inactivation of a molecule constituting these signal cascades (for example, due to a genetic abnormality of these molecules, suppression of expression or activity of GST-π, etc.).
[083] Therefore, the present invention also relates to a pharmaceutical composition for treating a disease associated with suppression of the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade, the pharmaceutical composition of which contains as an active ingredient GST-π and / or a functional variant thereof; a process for producing a pharmaceutical composition to treat a disease associated with the suppression of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade, the process of which includes a step of formulating GST-π and / or a functional variant thereof; use of GST-π and / or a functional variant thereof in the production of a pharmaceutical composition to treat a disease associated with the suppression of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / signal cascade MAPK; GST-π and / or a functional variant thereof for use in the treatment of a disease associated with the suppression of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade; and a method for treating a disease associated with suppression of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade, the method of which comprises administering an effective amount of GST-π and / or a functional variant of it.
[084] Therefore, the present invention also relates to an agent or composition to suppress the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade (also called a “suppression agent cascade suppression "or a" signal cascade suppression composition "), whose agent or composition contains a drug that suppresses GST-π as an active ingredient.
[085] In the present invention, suppressing a signal cascade means not only inducing inactivation of the signal cascade, but also suppressing activation of the signal cascade. Whether or not a signal cascade is suppressed can be determined by the signal cascade being suppressed, compared to a case where the agent or composition of the present invention is not used. Suppression of a signal cascade can be assessed by detecting, for example, but not limited to, reduction in activation (eg phosphorylation, etc.) of a molecule that constitutes a signal cascade or a cellular phenomenon resulting from suppression of the signal cascade such as, for example, increase or suppression of cell proliferation, etc., in the case of the RAS / Raf / MAPK signal cascade.
[086] The present invention also relates to a process for producing an agent or composition to suppress the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade, the process of which comprises a formulation step a drug that suppresses GST-π; use of a drug that suppresses GST-π in the production of an agent or composition to suppress the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade; a drug that suppresses GST-π for use in suppressing the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade; whose method comprises administering an effective amount of a drug that suppresses GST-π.
[087] The agent or composition for suppressing a signal cascade of the present invention is useful for the treatment of a disease associated with an abnormality of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / signal cascade / MAPK, in particular, with an activation of these signal cascades. Examples of such a disease include, but are not limited to, a disease associated with an increase in expression or activity and / or suppression of degradation or inactivation of a molecule constituting these signal cascades (for example, due to a genetic abnormality of these molecules, a increase in GST-π expression or activity) and a disease associated with activation of this signal cascade by means of a factor other than a constituent molecule of these signal cascades (for example, activation of tyrosine kinase receptor, etc.)
[088] Therefore, the present invention also relates to a pharmaceutical composition for treating a disease associated with the activation of the PI3K / Akt / mTOR signal cascade and / or RAS / Raf / MAPK signal cascade, the pharmaceutical composition of which contains as an active ingredient a drug that suppresses GST-π; a process for producing a pharmaceutical composition to treat a disease associated with the activation of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade, the process of which comprises a step of formulating a drug that suppresses GST-π; use of a drug that suppresses GST-π in the production of a pharmaceutical composition to treat a disease associated with the activation of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade; a drug that suppresses GST-π for use in the treatment of a disease associated with the activation of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade; and a method to treat a disease associated with the activation of the PI3K / Akt / mTOR signal cascade and / or the RAS / Raf / MAPK signal cascade, the method of which is to administer an effective amount of a drug that suppresses GST-π .
[089] The present invention also relates to an agent or composition to suppress ubiquitination (also called an "agent that suppresses ubiquitination" or a "composition that suppresses ubiquitination"), whose agent or composition contains as an active ingredient GST-π and / or a functional variant thereof.
[090] Ubiquitination means that ubiquitin binds to a protein and is involved in the process of disposing of a protein that becomes unnecessary in a cell. A ubiquirinated protein is broken down into a proteasome.
[091] In one embodiment of the present invention, the protein to which ubiquitination is suppressed is a protein to which GST-π can bind. In addition, in an embodiment of the present invention, the protein for which ubiquitination is suppressed is selected from the group consisting of a protein that constitutes the RAS / Raf / MAPK signal cascade, a protein that constitutes the PI3K / Akt / mTOR signal, and a tyrosine kinase receptor. In a preferred embodiment of the present invention, the protein for which ubiquitination is suppressed is selected from the group consisting of EGFR and Raf-1, in particular a phosphorylated form thereof.
[092] In the present invention, suppression of ubiquitination can be determined by ubiquitination being suppressed in comparison to a case where the agent or composition of the present invention is not used. Suppression of ubiquitination can be evaluated by any known technique, for example, but not limited to, an immunoprecipitation method, a western blot method, a mass analysis method, a pull-down method, etc.
[093] The present invention also relates to a process for producing an agent or composition to suppress ubiquitination, the process of which comprises a step of formulating GST-π and / or a functional variant thereof; use of GST-π and / or a functional variant thereof in the production of an agent or composition to suppress ubiquitination; and / or GST-π and / or a functional variant thereof for use in suppressing ubiquitination; and a method for suppressing ubiquitination, the method of which involves administering an effective amount of GST-π and / or a functional variant thereof.
[094] The agent or composition for suppressing ubiquitination of the present invention is useful in the treatment of a disease associated with hyperubiquitination. Examples of such a disease include, but are not limited to, a disease accompanied by an increase in expression or activity and / or a suppression of ubiquitin ligase degradation or inactivation (for example, due to a genetic abnormality of ubiquitin ligase, expression suppression or GST-π activity, etc.).
[095] Therefore, the present invention also relates to a pharmaceutical composition for treating a disease associated with hyperubiquitination, the pharmaceutical composition of which contains as an active ingredient GST-π and / or a functional variant thereof; a process for producing a pharmaceutical composition for treating a disease associated with hyperubiquitination, the process of which comprises a step of formulating GST-π and / or a functional variant thereof; use of GST-π and / or a functional variant thereof in the production of a pharmaceutical composition to treat a disease associated with hyperubiquitination; GST-π and / or a functional variant thereof for use in the treatment of a disease associated with hyperubiquitination; and a method for treating a disease associated with hyperubiquitination, the method of which comprises administering an effective amount of GST-π and / or a functional variant thereof.
[096] The present invention also relates to an agent or composition to promote ubiquitination (also called an "agent that promotes ubiquitination" or a "composition that promotes ubiquitination"), whose agent or composition contains as a active ingredient a drug that suppresses GST-π.
[097] In one embodiment of the present invention, the protein to which ubiquitination is promoted is a protein to which GST-π can bind. In addition, in an embodiment of the present invention, the protein for which ubiquitination is promoted is selected from the group consisting of a protein that constitutes the RAS / Raf / MAPK signal cascade, a protein that constitutes the cascade of PI3K / Akt / mTOR signal, and a tyrosine kinase receptor. In a preferred embodiment of the present invention, the protein to which ubiquitination is promoted is selected from the group consisting of EGFR and Raf-1, in particular a phosphorylated form thereof.
[098] In the present invention, ubiquitination promotion can be determined by ubiquitination being promotion in comparison to a case where the agent or composition of the present invention is not used. The promotion of ubiquitination can be evaluated by any known technique, for example, but not limited to, an immunoprecipitation method, a western blot method, a mass analysis method, a pull-down method, etc.
[099] The present invention also relates to a process for producing an agent or composition to promote ubiquitination, the process of which comprises a step of formulating a drug that suppresses GST-π; use of a drug that suppresses GST-π in the production of an agent or composition to promote ubiquitination; a drug that suppresses GST-π for use in promoting ubiquitination; and a method for promoting ubiquitination, the method of which is to administer an effective amount of a drug that suppresses GST-π.
[0100] The agent or composition for promoting ubiquitination of the present invention is useful in the treatment of a disease associated with suppression of ubiquitination. Examples of such a disease include, but are not limited to, a disease associated with suppression of expression or activity and / or an increase in ubiquitin ligase degradation or inactivation (for example, due to a genetic abnormality of ubiquitin ligase, an increase in expression or GST-π activity, etc.).
[0101] Therefore, the present invention also relates to a pharmaceutical composition for treating a disease associated with suppression of ubiquitination, the pharmaceutical composition of which contains a drug that suppresses GST-π as an active ingredient; a process for producing a pharmaceutical composition for treating a disease associated with suppression of ubiquitination, the process of which comprises a step of formulating a drug that suppresses GST-π; use of a drug that suppresses GST-π in the production of a pharmaceutical composition to treat a disease associated with suppression of ubiquitination; a drug that suppresses GST-π for use in the treatment of a disease associated with suppression of ubiquitination; and a method for treating a disease associated with suppression of ubiquitination, the method of which is to administer an effective amount of a drug that suppresses GST-π.
[0102] The present invention also relates to an agent or composition to suppress autophagy (also called an "agent that suppresses autophagy" or a "composition that suppresses autophagy"), whose agent or composition contains as an active ingredient GST-π and / or a functional variant thereof. The present inventors have now clarified that GST-π binds to a tyrosine kinase receptor, in particular a phosphorylated form of it, which is upstream of the PI3K / Akt / mTOR signal cascade, thereby inhibiting its ubiquitination, thereby promoting the signal cascade; Activation of the PI3K / Akt / mTOR signal cascade is known to suppress autophagy (for example, Yang and Klionsky, 2010 above).
[0103] In the present invention, suppression of autophagy can be determined by autophagy being suppressed, compared to a case where the agent or composition of the present invention is not used. The technique for assessing autophagy is as described above.
[0104] The present invention also relates to a process for producing an agent or composition to suppress autophagy, the process of which comprises a step of formulating GST-π and / or a functional variant thereof; use of GST-π and / or a functional variant thereof in the production of an agent or composition to suppress autophagy; and / or GST-π and / or a functional variant thereof for use in suppressing autophagy; and a method for suppressing autophagy, the method of which involves administering an effective amount of GST-π and / or a functional variant thereof.
[0105] The agent or composition for suppressing autophagy of the present invention is useful for the treatment of a disease associated with increased autophagy. Examples of such a disease include, but are not limited to, a disease associated with the suppression of the PI3K / Akt / mTOR signal cascade (for example, due to a genetic abnormality of a PI3K / Akt / mTOR signal cascade and / or molecule constituent and / or upstream molecule, suppression of GST-π expression or activity, etc.), myopathy, liver injury, reperfusion injury, etc.
[0106] Therefore, the present invention also relates to a pharmaceutical composition for treating a disease associated with increased autophagy, the pharmaceutical composition of which contains as an active ingredient GST-π and / or a functional variant thereof; a process for producing a pharmaceutical composition for treating a disease associated with increased autophagy, the process of which comprises a step of formulating GST-π and / or a functional variant thereof; use of GST-π and / or a functional variant thereof in the production of a pharmaceutical composition to treat a disease associated with increased autophagy; GST-π and / or a functional variant thereof for use in the treatment of a disease associated with increased autophagy; and a method for treating a disease associated with increased autophagy, the method of which is to administer an effective amount of GST-π and / or a functional variant thereof to a subject who needs it.
[0107] Furthermore, the present inventors have now clarified that autophagy is promoted by suppression of GST-π. Therefore, the present invention also relates to an agent or composition to promote autophagy (also called an "agent that promotes autophagy" or a "composition that promotes autophagy"), whose agent or composition contains as an active ingredient a drug that suppresses GST-π. The present invention also relates to a process for producing an agent or composition to promote autophagy, the process of which comprises a step of formulating a drug that suppresses GST-π; use of a drug that suppresses GST-π in the production of an agent or composition to promote autophagy; a drug that suppresses GST-π for use in promoting autophagy; and a method for promoting autophagy, the method of which is to administer an effective amount of a drug that suppresses GST-π.
[0108] The agent or composition for promoting autophagy of the present invention is useful in the treatment of a disease associated with suppression of autophagy. Examples of such a disease include, but are not limited to, a disease associated with the activation of the PI3K / Akt / mTOR signal cascade (for example, due to a genetic abnormality of a molecule that constitutes a PI3K / Akt / signal cascade) mTOR and / or a molecule upstream, an increase in GST-π expression or activity, etc.), aging and an ischemic disease.
[0109] Therefore, the present invention also relates to a pharmaceutical composition for treating a disease associated with suppression of autophagy, the pharmaceutical composition of which contains a drug that suppresses GST-π as an active ingredient; a process for producing a pharmaceutical composition for treating a disease associated with suppression of autophagy, the process of which comprises a step of formulating a drug that suppresses GST-π; use of a drug that suppresses GST-π in the production of a pharmaceutical composition to treat a disease associated with suppression of autophagy; a drug that suppresses GST-π for use in the treatment of a disease associated with suppression of autophagy; and a method for treating a disease associated with suppression of autophagy, the method of which is to administer an effective amount of a drug that suppresses GST-π to a subject who needs it.
[0110] The amount of active ingredient formulation of the various types of agent or composition of the present invention related to the suppression / promotion of a signal cascade, ubiquitination or autophagy can be an amount that achieves a desired effect (i.e., suppression / promotion signal cascade, ubiquitination or autophagy) when the agent or composition is administered. In addition, it is preferably an amount that does not cause an adverse effect that exceeds the administration benefit. This amount is known or can be determined appropriately by means of an in vitro test using cultured cells, etc., or a test on an animal model such as a mouse, a rat, a dog or a pig, and these methods of testing is well known to a person skilled in the art. The inhibition / promotion of a signal cascade, ubiquitination or autophagy can be assessed by known techniques, including those described above. The amount of active ingredient formulation may vary according to the mode of administration of the agent or composition. For example, when a plurality of units of the composition are used for an administration, the amount of active ingredient to be formulated in a unit of the composition can be that obtained by dividing the amount of active ingredient needed for an administration by said plurality of units . The adjustment of this amount of formulation can be performed properly by a technician in the subject.
[0111] The drug and the amount of its formulation in the production process or use of the various types of agents or composition related to the suppression / promotion of a signal cascade, ubiquitination or autophagy are as described above. The formulation of each drug can be carried out according to any known technique.
[0112] All the various types of methods related to the suppression / promotion of a signal cascade, ubiquitination or autophagy can be an in vitro method or an in vivo method. In addition, the effective amount of drug in the above methods can be an amount that achieves a desired effect (i.e., suppression / promotion of a signal cascade, ubiquitination or autophagy) to the cells to which it is administered. In addition, it is preferably an amount that does not cause an adverse effect that exceeds the administration benefit. This amount is known or can be determined appropriately by an in vitro test, etc., using cultured cells, etc., and this test method is well known to a person skilled in the art. The extent of a desired effect can be assessed by several known techniques, including those described above. The above effective amount does not necessarily need to be that which induces a desired effect on all cells in a cell population in which the drug is administered. For example, the effective amount above may be an amount that induces a desired effect on the cell population in at least 1% of the cells, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 8%, at least 10%, at least 12%, at least 15%, at least 20%, at least 25%, etc.
[0113] When the active ingredient in the various agents or compositions, methods of treatment, etc., of the present invention described in the present application is a nucleic acid, for example, an RNAi molecule, a ribozyme, an antisense nucleic acid, a polynucleotide DNA / RNA chimera, etc., can be used as a bare nucleic acid as it is, but it can also be carried out by various vectors. As a vector, any known vectors can be used, such as a plasmid vector, a phage vector, a phagemid vector, a cosmid vector, or a virus vector. The vector preferably contains at least one promoter that improves the expression of the charged nucleic acid, in which case the nucleic acid is preferably functionally linked to that promoter. The nucleic acid being functionally linked to that promoter referred to in the present application means that the nucleic acid and the promoter are positioned so that a protein encoded by the nucleic acid is appropriately produced by the action of the promoter. The vector may or may not be replicable in a host cell, and transcription of a gene can be performed both outside the nucleus and inside the nucleus of a host cell. In the latter case, the nucleic acid can be incorporated into the genome of a host cell.
[0114] In addition, the active ingredient can be loaded by various non-viral protein-carrying lipids. Examples of such carriers include, but are not limited to, cholesterol, a liposome, an antibody protomer, cyclodextrin nanoparticles, a fusion peptide, an aptamer, a biodegradable polylactic acid copolymer, and polymer; the efficiency of incorporation into cells can be improved (see, for example, Pirollo and Chang, Cancer Res. 2008; 68 (5): 1247-50, etc.). In particular, a cationic liposome or a polymer (for example, polyethyleneimine, etc.) is useful. Additional examples of polymers useful as a carrier include those described in US patents 2008/0207553, US 2008/0312174, etc.
[0115] With reference to the various pharmaceutical compositions of the present invention described in the present application, the active ingredient can be combined with another optional component, as long as the effect of the active ingredient is not compromised. Examples of such an optional component include another chemical therapeutic agent, a pharmacologically acceptable carrier, an excipient, a diluent, etc. In addition, depending on the route of administration, the mode of drug release, etc., the composition can be coated with an appropriate material such as, for example, an enteric layer or a determined disintegration material, or it can be incorporated into a appropriate drug delivery system.
[0116] The various agents and compositions (including the various pharmaceutical compositions) of the present invention described in the present application can be administered via various routes including both oral and parenteral routes, for example, without limitation, oral, intravenous, intramuscular, subcutaneous, local, intratumoral, rectal, intraarterial, intraportal, intraventricular, transmucosal, transdermal, intranasal, intraperitoneal, intrapulmonary, and intrauterine route, and can be formulated in the form of convenient dosage for each route of administration. With reference to these dosage forms and formulation methods, any known form or method can be employed appropriately (see, for example, Hyojun yakuzaigaku (Standard Pharmaceutical Science), Ed. By Yoshiteru Watanabe et al., Nankodo, 2003, etc. ).
[0117] Examples of the suitable dosage form for oral administration include, but are not limited to, a powder, granules, a tablet, a capsule, a liquid, a suspension, an emulsion, a gel, and a syrup, and examples of Dosage forms suitable for parenteral administration include an injection, such as a solution for injection, a suspension for injection, an emulsion injection, or an injection in the form that is prepared at the time of use. A formulation for parenteral administration can be in the form of a sterile isotonic solution or aqueous or non-aqueous suspension.
[0118] The various agents or compositions (including various pharmaceutical compositions) of the present invention described in the present application can be targeted to a specific tissue or cells. Targeting can be performed by any known technique. When distribution to cancer is attempted, for example, without limitation, a technique such as passive targeting in which a formulation is made in a size of 50 to 200 μm in diameter, in particular 75 to 150 μm, etc., which is suitable for displaying an EPR effect (increased permeability and retention), or active targeting in which a CD19 ligand, HER2, a transferrin receptor, a folic acid receptor, a VIP receptor, EGFR (Torchilin, AAPS J. 2007 ; 9 (2): E128-47), RAAG10 (JP, A (PCT) 2005-532050), PIPA (JP, A (PCT) 2006-506071), or KID3 (JP, A (PCT) 2007-529197) , etc., a peptide that has an RGD motif or an NGR, F3, LyP-1 motif (Ruoslahti et al., J Cell Biol. 2010; 188 (6): 759-68), etc., is used as a targeting agent, can be used. In addition, since a retinoid is known to be useful as a targeting agent for cancer cells (WO 2008/120815), a carrier containing a retinoid as a targeting agent can also be used. These carriers are described in the literature above, as well as in WO 2009/036368, WO 2010/014117, etc.
[0119] The various agents or compositions (including various pharmaceutical compositions) of the present invention described in the present application can be provided in any form, and from the point of view of storage stability, can be provided in the form that can be prepared on the spot. of use, for example, in the form that allows a doctor and / or pharmacist, a nurse, another paramedic, etc., to prepare them at the medical site or in your neighborhood. This form is particularly useful when the agent or composition of the present invention contains a component that is difficult to store stably, such as a lipid, protein or nucleic acid. In this case, the agent or composition of the present invention is supplied in one or more containers containing at least one of the essential constituents, and the preparation is carried out before use, for example, within 24 hours, preferably within 3 hours, and more preferably immediately before use. When carrying out the preparation, a reagent, a solvent, a preparation equipment, which are generally available at a preparation site, can be used as appropriate.
[0120] Therefore, the present invention also relates to a kit for preparing a composition, the kit of which contains one or more containers, the container alone or in combination containing active ingredients to be contained in the various agents or compositions of the present invention; and essential constituents of the various agents or compositions provided in the form of that kit. The kit of the present invention may include, in addition to the above, instructions such as a written explanation or an electronic recording medium such as a CD or DVD describing a method of preparation, a method of administration, etc., for the various agents or compositions of the present invention. In addition, the kit of the present invention may contain all of the constituents to complete the various agents or compositions of the present invention, but it need not necessarily contain all of the constituents. Therefore, the kit of the present invention should not contain a reagent or solvent that is generally available at a medical location, an experimental laboratory, etc., such as sterile water, physiological saline, or a glucose solution.
[0121] The effective amount of the various treatment methods of the present invention described in the present application is, for example, an amount that reduces the symptoms of a disease or delays or stops the progression of a disease, and is preferably an amount that suppresses or cures a disease. It is also preferably an amount that does not cause an adverse effect that exceeds the benefit of administration. This amount can be appropriately determined by an in vitro mouse, rat, dog or pig test, and these test methods are well known to a person skilled in the art. In addition, the dose of a drug used in the treatment method of the present invention is known to a person skilled in the art or can be appropriately determined by the tests described above, etc.
[0122] The specific dose of the active ingredient to be administered in the treatment method of the present invention described in the present application can be determined taking into account various conditions related to the subject in need of treatment, such as the seriousness of symptoms, the subject's general state of health, age, body weight, the subject's gender, diet, the timing and frequency of administration, concomitant pharmaceuticals, responsiveness to treatment, dosage form, and compliance with treatment.
[0123] Examples of the route of administration include various routes, including both oral and parenteral routes, such as oral, intravenous, intramuscular, subcutaneous, local, intratumoral, rectal, intraarterial, intraportal, intraventricular, transmucosal, transdermal, intranasal routes , intraperitoneal, intrapulmonary, intrauterine.
[0124] The frequency of administration depends on the properties of the agent or composition used and the condition of the subject, including those described above, and can be a plurality of times a day (that is, two, three, four, five or more times a day). day), once a day, every few days (that is, every two, three, four, five, six, seven days, etc.), every week, every few weeks (that is, every two, three, four weeks, etc.), etc.
[0125] When used in the present application, the term "subject" means any biological individual and is preferably an animal, more preferably a mammal, and yet more preferably a human individual. In the present invention, the subject may be either healthy or affected by some disease, but when an attempt is made to treat a specific disease, it usually means a subject affected by that disease or who is at risk of being affected.
[0126] In addition, when used in the present application, the term "treatment" includes all types of preventive and / or therapeutic interventions clinically permitted for the purposes of cure, temporary remission, prevention, etc., of a disease. For example, the term "treatment" includes clinically permitted interventions for a variety of purposes, including delaying or stopping the progress of a disease, causing an injury to regress or disappear, preventing the onset or preventing recurrence. EXAMPLES
[0127] The present invention is further explained below based on the Examples, but these Examples are only illustrations of the present invention and are not to be construed as limiting the present invention. EXAMPLE 1 KNOCKOUT EFFECT OF GST-n ON RAS / RAF / MAPK SIGNATURE CASCADE (1) CELL CULTURE
[0128] Colon carcinoma cell line with positive K-RAS M7609 mutation was cultured in 10% fetal bovine serum (FBS) containing RPMI-1640 medium at 37 ° C under an atmosphere containing 5% CO2. In addition, 100 U / mL of penicillin and 100 μg / mL of streptomycin were added as antibiotics to the medium. (2) TRANSFECTION OF GST-n SYNDROME
[0129] The day before the transfection, M7609 cells were plated on a 100 mm tissue culture plastic plate using RPMI-1640 medium containing 10% FBS without antibiotics in order to give 1 x 106 cells / 10 mL . 600 pmol of GST-π siRNA (SEQ ID NO: 1: GGGAGGCAAGACCUUCAUUTT, siRNA ID No. 2385, Ambion) was added to 1 ml of Opti-MEM I Reduced Serum Medium (GIBCO) and mixed gently. Subsequently, 35 μL of Lipofectamine RNAiMAX (Invitrogen) was diluted in 1 ml of Opti-MEM I Reduced Serum Medium and mixed gently. The diluted GST-π siRNA and the diluted Lipofectamine RNAiMAX were combined and mixed gently, and then incubated at room temperature for 10 min. During that time, the medium was replaced with 10 mL of Opti-MEM I Reduced Serum Medium. After 10 min. incubation, the complex between GST-π siRNA and Lipofectamine RNAiMAX was added to the cells and incubated at 37 ° C under an atmosphere containing 5% CO2. After 5 hours of incubation, it was replaced with 10 ml of RPMI-1640 medium containing 10% FBS without containing antibiotics. As a control experiment, the same procedure was repeated using siRNA Scramble (SEQ ID No: 2: CGAUUCGCUAGACCGGCUUCAUUGCAG, Hokkaido System Science Co., Ltda.). On the 1st, 2nd, 3rd and 4th day after transfection with GST-π siRNA, the number of cells was counted, and GST-π knockdown was examined. The knockdown of GST-π was analyzed by a Western Blot method as described below. (3) WESTERN BLOT KNOCKDOWN ANALYSIS OF GST-n
[0130] Western blot analysis of GST-π was performed using cells collected at each point in the time mentioned above after transfection with GST-π siRNA. The collected cells were cultured for 16 hours in a serum-free medium. After the cells are washed with cold PBS, cold lysis buffer (1% NP-40, 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, Complete EDTA free mini (Roche), PhosSTOP (Roche) , pH 7.5) was added, and solubilization was carried out by incubation for 30 min while cooling on ice. Centrifugation was carried out at 4 ° C and 15000 rpm for 15 min, thus providing a cell extract. The cell extract thus obtained was subjected to quantitative protein analysis using a Micro BCA Protein Assay Kit (Thermo SCIENTIFIC) (transfectant GST-π siRNA: 4.35 μg / μL, mixture of transfectant siRNA: Subsequently, 20 μg of the cell extract was denatured under conditions of reduction, and the protein was separated using SDS-PAGE using a multi gel II Mini 4/20 (13W) (Cosmo Bio Co., Ltda.). After SDS -PAGE was completed, the transfer to a PVDF membrane was performed electrically using a tank-type blotting system The transfer membrane was blocked by incubation with 5% skimmed milk / 0.05% Tween20 in PBS (abbreviated to PBS- T) at 4 ° C for 16 hours. Subsequently, a reaction with anti-GST antibody diluted in PBS-T (MBL) was carried out at 4 ° C for 16 hours. rabbit labeled with horseradish peroxidase (HRP) for 1 hour. A chemiluminescent substrate was then carried out at room temperature for 1 min, and then this chemiluminescence was detected with the use of an X-ray film. The washing between operations was carried out three times by shaking for 5 min with the use of PBS-T . In addition, after transfection with siRNA, plating on a plastic tissue culture disk was performed to provide 1.0 x 105 cells / 5 mL, and the total cell count in the dish was measured with the use of a hemocytometer until the 4th day. (4) WESTERN BLOT ANALYSIS OF PROTEIN INVOLVED IN THE RAS / RAF / MAPK SIGNATURE CASCADE
[0131] A western blot analysis for the main protein involved in the RAS / Raf / MAPK signal cascade was performed in the same way as for (3) above, using cells harvested on the 2nd day after transfection with GST siRNA -π. As antibodies, in addition to the anti-GST-π antibody, anti-p-Raf-1 antibody (Ser338) (MILLIPORE), anti-Raf-1 antibody (Santa Cruz), anti-p-MEK1 / 2 antibody (Ser217 / 221 ) (Cell Signaling), anti-MEK1 / 2 antibody (Cell Signaling), anti-p-ERK1 / 2 antibody (Thr202 / Tyr204) (Cell Signaling), anti-ERK antibody (Cell Signaling), and anti-GAPDH antibody ( Abcam) were used.
[0132] The results are shown in Figures 1 and 2. In Figure 1 a), it was observed that GST-π expression was suppressed by GST-π siRNA, but was not suppressed by siRNA mixing. In Figure 1 b), it was found that even at the time point when 4 days had elapsed after transfection, GST-π expression was still stably suppressed by GST-π siRNA and, in addition, in the case of expression of GST-π. GST-π being suppressed, the number of cells after cultivation for 4 days was noticeably less than in the case of no suppression. In addition, it was also evident from Figure 2 that in the group treated with GST-π siRNA, the phosphorylation of all proteins involved in the RAS / Raf / MAPK signal cascade decreased compared to the group treated with a mixture of siRNA . Therefore, it is clear that, due to suppression of GST-π expression, the RAS / Raf / MAPK signal cascade and the abnormality of cell proliferation have been suppressed. EXAMPLE 2 KNOCKOUT EFFECT OF GST-Π ON UBIQUITINATION (1) KNOCKDOWN EFFECT OF GST-π ON RAF-1 UBIQUITINATION
[0133] M7609 cell culture and transfection with GST-π siRNA were performed according to the procedures of Example 1 (1) and (2).
[0134] In the same way as in Example 1 (3), on the 2nd day after transfection with siRNA, the culture was performed for 16 hours in a serum-free medium, and a cell extract was collected. The cell extract thus obtained was subjected to quantitative protein analysis using a Micro BCA Protein Assay Kit (Mixture of siRNA: 8.88 μg / μL, GST-π siRNA: 7.18 μg / mL). 0.5 μg of the cell extract was mixed with anti-Raf-1 antibody conjugated to Dynabeads Protein G (Invitrogen), incubation was carried out at 4 ° C for 2 hours with gentle mixing in a mixer to isolate the Raf-1 protein , and then a western blot analysis was performed in the same manner as in Example 1 (3) with the use of an anti-ubiquitin antibody (Santa Cruz). The phosphorylation modification of Ser621, which is involved in the inhibition of Raf-1 proteasome degradation, has been investigated in the same way with the use of an anti-p-Raf-1 antibody (Ser621) (MILLIPORE). (2) EFFECT OF PROTEASOMA INHIBITOR ON RAF-1 EXPRESSION THROUGH GST-n KNOCKDOWN
[0135] M7609 cell culture and transfection with GST-π siRNA were performed according to the procedures of Example 1 (1) and (2). On the 2nd day after transfection of GST-π siRNA, the culture was performed for 16 hours in a serum-free medium. After treatment with 5 μM of MG132 for 4 hours, a cell extract was collected. As a control for treatment with MG132, treatment with DMSO 0.05% was performed in the same way. The cell extract thus obtained was subjected to quantitative protein analysis using a Micro BCA Protein Assay Kit (group treated with a mixture of siRNA-DMSO: 3.36 μg / μL, group treated with a mixture of siRNA-MG132: 3.16 μg / μL, group treated with a mixture of -DMSO siRNA: 3.12 μg / μL, group treated with a mixture of GST-π-MG132 siRNA: 3.16 μg / μL). 20 μg of the cell extract was subjected to SDS-PAGE, and then western blot analysis was performed in the same manner as in Example 1 (3) with the use of an anti-p-Raf-1 antibody (Ser338) and an anti -Raf-1. (3) COIMUNOPRECIPITATION OF P-RAF-1 AND GST-n
[0136] M7609 cell culture was performed according to the procedure of Example 1 (1). Subsequently, after the GST-π knockdown cells obtained by the procedure of Example 1 (2) are washed with cold PBS, a cold coimmunoprecipitation buffer (0.5% NP-40, 50 mM HEPES, 150 mM NaCl, 1 mM EGTA, 1.5 mM MgCl2, Mini complete EDTA-free, PhosSTOP, pH 7.5) was added, and solubilization was carried out by incubation for 30 min while cooling on ice. Centrifugation was carried out at 4 ° C and 15000 rpm for 15 min, thus providing a cell extract. The cell extract thus obtained was subjected to quantitative protein analysis using a Micro BCA Protein Assay Kit (12.1 μg / μL). 1 mg of the cell extract was mixed with anti-p-Raf-1 antibody (Ser338) (US Biological) conjugated to Protein G Dynabeads, and incubation was carried out at 4 ° C for 16 hours by gently mixing in a mixer, performing thus coimmunoprecipitation. Subsequently, a western blot analysis was performed using a GST-π antibody.
[0137] The results are shown in Figures 3 to 5. It was clear from Figure 3 that in the group treated with GST-π siRNA the amount of ubiquitin co-precipitated with Raf-1 was large compared to the group treated with mixture of siRNA, and Raf-1 ubiquitination was increased. In addition, it can be seen from Figure 4 that the proteasome was involved in the reduction of p-Raf-1 expression by GST-π siRNA, and it can be seen from Figure 5 that GST-π was bound to p-Raf-1. The above results suggest that GST-π binds p-Raf-1 to thereby inhibit its ubiquitination and, due to suppression of GST-π, the ubiquitination of p-Raf-1 is promoted, and the abundance of p- Raf-1 is reduced. EXAMPLE 3 ANALYSIS OF INDUCTION OF AUTOPHAGY AND APOPTOSIS BY KNOCKDOWN OF GST-n (1) ANALYSIS OF AUTOPHAGY INDUCTION BY IMMUNOFLUORESCENCE COLORING
[0138] Induction of autophagy by GST-π knockdown was analyzed by immunofluorescence staining with LC3, which is a specific autophagy marker protein. The GST-π knockdown cells obtained by the procedure of Example 1 (2) were plated on a coverslip placed in a plastic tissue culture dish in order to provide 1 x 105 cells / 2 ml. After the medium was aspirated, paraformaldehyde 4% in PBS was added, and the incubation was carried out at room temperature for 10 min, thus fixing the cells. The permeabilization of the cells was performed with the use of 0.5% Triton X-100 in PBS on ice for 5 min. After washing with cold PBS for 10 min, a reaction with anti-LC3B antibody (Invitrogen) diluted with 1% BSA containing PBS was carried out in a humid chamber at 37 ° C for 1 hour. A secondary antibody reaction was performed using Alexa Fluor488-labeled rabbit antibody (Invitrogen) at 37 ° C for 1 hour. Mounting on a glass slide was performed using Prolong Gold antifade reagent with DAPI, and incubation was performed at 4 ° C for 16 hours. The wash after the reaction with the antibody was performed three times with the use of PBS at 37 ° C for 5 min. Autophagy positive cells at the time of examination with a fluorescence microscope were defined as cells having an LC3 signal similar to a spot present in the cytoplasm. (2) AUTOPHAGY INDUCTION ANALYSIS BY WESTERN BLOTTING
[0139] The induction of autophagy in GST-π knockdown cells was further analyzed by a western blot analysis of LC3. The GST-π knockdown cells obtained by the procedure of Example 1 (2) were plated on a coverslip placed in a plastic tissue culture dish to provide 1 x 105 cells / 2 ml. After incubation for a predetermined time, a cell extract was collected and subjected to western blot analysis. A transfer membrane reaction was carried out at 4 ° C for 16 hours using anti-LC3B antibody (SIGMA) as a primary antibody. The detection of LC3 molecules was performed using a chemiluminescent reagent after a reaction with secondary antibody labeled with HRP. Whether or not autophagy was induced was assessed by a change from LC3 from type I (18 kDa) to type II (16 kDa). (3) ANALYSIS OF AUTOPHAGY INDUCTION BY EXAMINATION WITH ELECTRONIC MICROSCOPE
[0140] On the 1st day after siRNA transfection in Example 1 (2), the cells were plated on a culture plate with 8 wells for tissue culture in order to provide 0.4 x 105 cells / 0.5 ml. Fixation was performed with the use of 2.5% glutaraldehyde in 0.1 M cacodylic acid buffer (pH 7.4) for 1 hour, and after rinsing with 0.1 M cocadylic acid buffer, post fixation was performed with the use of OsO4 and 1.5% potassium ferrocyanide 1.5% for 2 hours. After dehydration was performed three times with ethanol for 10 min, incorporation into an epoxy resin (TAAB Laboratories Equipment) was performed. An ultrathin cut was prepared using a diamond knife, electron staining was performed using uracil acetate and lead citrate and the cut was examined using electron microscopy (Hitachi Transmission Electron Microscope H-7500, Hitachi High-Technologies Corporation). (4) ANALYSIS OF APOPTOSIS INDUCTION BY TUNEL COLORING
[0141] A TUNEL method was performed as follows with the use of an In Situ Cell Death Detection Kit, POD (Roche). The GST-π knockdown cells obtained by the procedure of Example 1 (2) were plated on a coverslip placed in a plastic tissue culture dish to provide 1 x 105 cells / 2 ml. After the medium was aspirated, 4% paraformaldehyde in PBS was added, and the incubation was carried out at room temperature for 60 min, thus fixing the cells. In order to block endogenous peroxidase, incubation was carried out with 3% H2O2 in methanol at room temperature for 10 min. Subsequently, cell permeabilization was carried out by treatment with 0.1% Triton X-100 in 0.1% sodium citrate on ice for 2 min. The TUNEL reaction was carried out in a humid chamber at 37 ° C for 60 min. The detection of TUNEL positive cells was performed by a staining reaction using a DAB substrate after reaction with peroxidase-labeled anti-fluorescein antibody at 37 ° C for 30 min. Counterstaining was performed using hematoxylin, the stained cells were examined with light microscopy, and the TUNEL positive cells were evaluated as apoptotic cells. The washing between operations was performed by rinsing with PBS.
[0142] The results are shown in Figures 6 to 10. Figure 6 is an immunofluorescence image with anti-LC3 antibody, and a signal similar to spots showing LC3 was observed in the cells shown by arrows. Since this LC3 stain-like signal could be autophagosome, it can be seen that the GST-π knockdown cells autophagy was induced.
[0143] Figure 7 shows electron microscopy examination images of GST-π KD cells 2 days after transfection of GST-π siRNA. The image on the right is an enlargement of part A surrounded by a square in the image on the left. In the image on the right, it can be seen that in the parts shown by arrows, an autophagosome was formed in order to surround the mitochondria.
[0144] Figure 8 shows the results of LC3 western blotting. There are two types of LC3 protein that are recognized by an anti-LC3 antibody. When autophagy occurs and LC3 is incorporated into a double lipid membrane, LC3 changes from type I to type II. Therefore, it is possible to confirm whether or not autophagy was induced from a change in the amount of LC3 type II detected. From the result of Figure 8, it can be seen that in the group treated with GST-π siRNA, the expression of both, LC3 type I and II, was induced and type II was markedly increased, while in the group treated with a mixture of siRNA, expression was low for both type I and type II, and type I expression level was lower than type II.
[0145] From these results, it can be seen that autophagy is induced by suppression of GST-π expression.
[0146] Figure 9 shows the TUNEL staining results. The upper line shows images of the group treated with a mixture of siRNA, the lower line shows images of the group treated with siRNA of GST-π; in GST-π knockdown cells, TUNEL positive cells, that is, apoptosis, were observed.
[0147] Figure 10 is a graph showing changes over time in the proportions of cells positive for autophagy and cells positive for apoptosis in the group treated with siRNA GST-π and in the group treated with siRNA of GST-π. The proportion of cells positive for autophagy denotes the proportion of cells that have a spot-like LC3 signal per 500 cells in the immunofluorescence staining experiment using the anti-LC3 antibody in (1) above, and the proportion of positive cells for apoptosis it denotes the proportion of TUNEL positive cells per 1000 cells in the TUNEL staining experiment in (4) above. It can be seen from this that the proportion of positive cells for autophagy increased rapidly after treatment, peaking on the 2nd day, and then decreasing, while the proportion of positive cells for apoptosis gradually, but continued to increase until the 4th morning. EXAMPLE 4 KNOCKOUT EFFECT OF GST-n ON THE EGFR / PI3K / AKT / MTOR SIGNATURE (1) WESTERN BLOT ANALYSIS OF EGFR / PI3K / AKT / MTOR
[0148] The expression of each protein that constitutes the EGFR / PI3K / Akt / mTOR signal cascade was analyzed in the same way as in Example 1 (1), (2) and (4), except that as primary antibodies, antibody anti-p-EGFR (Tyr1068) (Cell Signaling), anti-EGFR antibody (Santa Cruz), anti-p-PI3K antibody p85 (Tyr458) / p55 (Tyr199) (Cell Signaling), anti-PI3K antibody, p85 (MILLIPORE ), anti-p-Akt (Ser473) antibody (Cell Signaling), anti-Akt (Cell Signaling) antibody, anti-p-p70S6K (Thr389) antibody (Cell Signaling), anti-p-p70S6K antibody (Thr421 / Ser424) (Cell Signaling), and anti-p70S6K antibody (Cell Signaling) were used. (2) EFFECT OF PROTEASOMA INHIBITOR ON P-EGFR EXPRESSION THROUGH GST-n KNOCKDOWN
[0149] M7609 cell culture and transfection with GST-π siRNA were performed according to the procedures of Example 1 (1) and (2). On the 2nd day after transfection of GST-π siRNA, the cells were cultured in serum-free medium for 16 hours. After treatment with 5 μM of MG132 for 2 hours, a cell extract was collected. As a control for treatment with MG132, treatment with DMSO 0.05% was performed in the same way. The cell extract thus obtained was subjected to quantitative protein analysis using a Micro BCA Protein Assay Kit (group treated with a mixture of siRNA-DMSO: 11.98 μg / μL, group treated with a mixture of siRNA-MG132: 12.29 μg / μL, group treated with a mixture of siRNA-DMSO: 8.91 μg / μL, group treated with a mixture of siRNA from GST-π-MG132: 9.24 μg / μL). After 80 μg of the cell extract was submitted to SDS-PAGE, a western blot analysis was performed using anti-p-EGFR antibody (Tyr1068) and anti-EGFR antibody. (3) COIMMUNOPRECIPITATION OF P-EGFR AND GST-n
[0150] M7609 cell culture was performed according to the procedure of Example 1 (1). Subsequently, after the cells were washed with cold PBS, a cold coimmunoprecipitation buffer (Triton X-100 1.0%, 50 mM Tris-HCl, 150 mM NaCl, Complete EDTA free mini, PhosSTOP, pH 7.5) added, and solubilization was carried out by incubation for 30 min while cooling on ice. Centrifugation was carried out at 4 ° C and 12000 rpm for 10 min, thus providing a cell extract. The cell extract thus obtained was subjected to quantitative protein analysis using a Micro BCA Protein Assay Kit (9.08 μg / μL). 1 mg of the cell extract was mixed with anti-p-EGFR antibody (Tyr1068) (Calbiochem) conjugated to Protein G Dynabeads, and coimmunoprecipitation was performed by incubation in a mixer at 4 ° C for 16 hours while mixing gently. Subsequently, a western blot analysis was performed using a GST-π antibody.
[0151] The results are shown in Figures 11 to 13. Figure 11 shows that in the group treated with GST-π siRNA the phosphorylation of each protein constituting the EGFR / PI3K / Akt / mTOR signal cascade was reduced, in comparison with the group treated with a siRNA mixture, Figure 12 shows that the proteasome is involved in the reduction of p-EGFR expression by GST-π siRNA, and Figure 3 shows that GST-π is bound to p-EGFR. The above results suggest that GST-π binds to p-EGFR to contribute to its stabilization, the ubiquitination of p-EGFR is promoted by suppression of GST-π, and the abundance of p-EGFR decreases. EXAMPLE 5 EFFECT OF GST-n INHIBITOR ON CELLULAR PROLIFERATION, ETC. (1) EFFECT OF GST-n INHIBITOR ON EGFR AND RAF-1 PHOSPHORILATION
[0152] M7609 cell culture was performed according to the procedure of Example 1 (1). The cells were plated on a 60 mm tissue culture plastic dish to provide 105 cells / 5 mL. G16-π inhibitor C16C2 (prepared by Teijin Pharma Limited on request) was added in order to provide 10, 50 and 100 μM, and after 24 hours a cell extract was collected. The cell extract thus obtained was subjected to quantitative protein analysis using a Micro BCA Protein Assay Kit (untreated: 8.5 μg / μL, 10 μL: 8.49 μg / μL, 50 μM: 7, 68 μg / μL, 100 μM: 6.4 μg / μL). 50 μg of the cell extract was submitted to SDS-PAGE, and the expression of each protein was then analyzed by the western blotting method. (2) EFFECT OF GST-n INHIBITOR ON CELLULAR PROLIFERATION, ETC.
[0153] M7609 cell culture was performed according to the procedure of Example 1 (1). The cells were plated in a 60 mm plastic tissue culture dish to provide 1.0 x 105 cells / 5 ml. After 16 hours, the GST-π inhibitor was added to provide 50 μM. The total cell count in the dish was measured using a hemocytometer until the 2nd day. As a control for the GST-π inhibitor, treatment with 0.05% DMSO was performed.
[0154] The results are shown in Figures 14 and 15. It became clear from these results that the GST-π inhibitor could also suppress EGFR and Raf-1 phosphorylation (Figure 14) and cell proliferation (Figure 15 ) in the same way as with the GST-π knockdown. EXAMPLE 6 EFFECT OF AUTOPHAGY INHIBITOR ON GST KNOCKDOWN CELLS (1) CELL CULTURE
[0155] The transfection of GST-π siRNA was performed according to the procedures of Example 1 (2), the medium was then replaced with an antibiotic-free medium, and the incubation was carried out for 3 hours. The cells were plated on a coverslip placed in a plastic tissue culture dish, the autophagy inhibitor 3-methyl adenine (3-MA, SIGMA) was added in order to provide 1 or 5 mM, and then this culture was performed for a predetermined time. (2) EVALUATION OF POSITIVE CELLS FOR AUTOPHAGY
[0156] The cells grown in (1) were subjected to immunofluorescence staining with the use of anti-LC3 antibody in the same manner as in Example 3 (1). (3) TUNEL COLORING
[0157] The cells grown in (1) were subjected to TUNEL staining in the same manner as in Example 3 (4).
[0158] The results are shown in Figures 16 to 18. Figure 16 shows the proportion of cells positive for autophagy per 1000 cells in each group, and it can be seen that the proportion of cells positive for autophagy noticeably decreased by the autophagy inhibitor . In Figure 17, the top line shows the group treated with GST-π + 1 mM 3-MA siRNA and the bottom line shows the group treated with GST-π + 5 mM 3-MA siRNA. It can be seen from Figures 9 and Figure 17 that apoptosis positive cells increased markedly due to the use of an autophagy inhibitor in combination. Figure 18 is a graph showing that apoptosis was further induced by an autophagy inhibitor in a dose dependent manner. Apoptosis was induced by the addition of GST-π siRNA, but when 3-MA, which is an autophagy inhibitor, was added, apoptosis was further induced depending on the additional dose of 3-MA. Therefore, it has become clear that apoptosis can be induced more efficiently by combining a drug that suppresses GST-π and a drug that suppresses autophagy.

权利要求:
Claims (4)
[0001]
1. USE OF AN AGENT that comprises as active ingredients a drug that suppresses GST-π and a drug that suppresses autophagy, characterized by being in the manufacture of a pharmaceutical composition for the treatment of cancer due to overexpression of GST-π and KRAS mutation , in which the autophagy-suppressing drug is a PI3K inhibitor, and in which the PI3K inhibitor is a class III PI3K inhibitor.
[0002]
USE, according to claim 1, characterized in that the PI3K inhibitor is 3-methyladenine.
[0003]
3. USE, according to claim 1, characterized in that the PI3K inhibitor is selected from the group consisting of an RNAi molecule, ribozyme, antisense nucleic acid, DNA / RNA chimera polynucleotide and a vector that expresses the same.
[0004]
4. USE, according to any one of claims 1 to 3, characterized in that the drug suppressing GST-π is selected from the group consisting of an RNAi molecule, ribozyme, antisense nucleic acid, DNA / RNA chimera polynucleotide and a vector that expresses the same.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112013033072B1|2021-04-13|USE OF AN AGENT

---

US9914983B2|2018-03-13|Apoptosis-inducing agent

---

US10093931B2|2018-10-09|Apoptosis inducer

---

WO2014046617A1|2014-03-27|Compositions and methods for treating cancer

---

JP2021054841A|2021-04-08|Cell death inducing agents for cells having mutation in braf gene, growth suppressing agents for such cells and pharmaceutical compositions for treating diseases caused by abnormal proliferation of the cells

---

Jung et al.2013|Mitochondrial UQCRB regulates VEGFR2 signaling in endothelial cells

---

Tian et al.2021|HYD-PEP06 suppresses hepatocellular carcinoma metastasis, epithelial–mesenchymal transition and cancer stem cell-like properties by inhibiting PI3K/AKT and WNT/β-catenin signaling activation

---

JP5611953B2|2014-10-22|Tyrosine kinase receptor TYRO3 as a therapeutic target in the treatment of cancer

---

TWI651093B|2019-02-21|Apoptosis-inducing agent

---

Wang et al.2021|Loss of TXNDC12 Induces Oxidative Stress-mediated Autophagy in Glioblastoma Cell Lines

---

Wang et al.2012|Weizhao

---

Jasukaitienė2016|Role of CUGBP2 and HuR mediated post-transcriptional regulation in anti-cancer drugs resistance of pancreatic adenocarcinoma: doctoral dissertation: biomedical sciences, biology |

---

Gallienne2014|Combined treatment of canine osteosarcoma cells with gene knock-down and chemotherapy

---

Durrant2015|Dual PI3K/mTOR inhibition with BEZ235 augments the therapeutic efficacy of doxorubicin in cancer without influencing cardiac function

---

WO2006132401A1|2006-12-14|Method for evaluation of compound using rsk1

同族专利:

---

公开号 | 公开日

---

KR20140041770A|2014-04-04|

---

AU2011371755A1|2014-01-30|

---

RU2014101547A|2015-07-27|

---

US20140315975A1|2014-10-23|

---

RU2639459C2|2017-12-21|

---

CA2841203A1|2012-12-27|

---

JPWO2012176282A1|2015-02-23|

---

KR101786905B1|2017-10-19|

---

EP2724729A1|2014-04-30|

---

BR112013033072A2|2017-11-28|

---

CA2841203C|2019-01-22|

---

ES2708932T3|2019-04-12|

---

EP2724729B1|2018-12-26|

---

AU2011371755B2|2017-09-07|

---

JP6023709B2|2016-11-09|

---

CN103619355A|2014-03-05|

---

WO2012176282A1|2012-12-27|

---

EP2724729A4|2015-04-15|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US5786336A|1991-04-29|1998-07-28|Terrapin Technologies, Inc.|Target-selective protocols based on mimics|

---

WO1996040205A1|1995-06-07|1996-12-19|Terrapin Technologies, Inc.|Metabolic effects of certain glutathione analogs|

---

AU766515B2|1998-04-16|2003-10-16|Teijin Limited|Glutathione derivatives and dosage forms thereof|

---

JP3803318B2|2001-11-21|2006-08-02|株式会社ＲＮＡｉ|Gene expression inhibition method|

---

DE60335022D1|2002-06-19|2010-12-30|Raven Biotechnologies Inc|Internalizing antibodies specific for the RAAG10 cell surface target|

---

US20040029275A1|2002-08-10|2004-02-12|David Brown|Methods and compositions for reducing target gene expression using cocktails of siRNAs or constructs expressing siRNAs|

---

EP1581096A4|2002-11-13|2006-06-21|Raven Biotechnologies Inc|Antigen pipa and antibodies that bind thereto|

---

KR20060079236A|2003-09-18|2006-07-05|레이븐 바이오테크놀로지스, 인코퍼레이티드|Kid3 and kid3 antibodies that bind thereto|

---

US7358223B2|2004-10-04|2008-04-15|Nitto Denko Corporation|Biodegradable cationic polymers|

---

US20080269259A1|2005-01-19|2008-10-30|The Trustees Of The University Of Pennsylvania|Regulation of Autophagy and Cell Survival|

---

TWI407971B|2007-03-30|2013-09-11|Nitto Denko Corp|Cancer cells and tumor-related fibroblasts|

---

US20080312174A1|2007-06-05|2008-12-18|Nitto Denko Corporation|Water soluble crosslinked polymers|

---

CN101970012A|2007-09-14|2011-02-09|日东电工株式会社|Drug carriers|

---

CN102159247A|2008-07-30|2011-08-17|日东电工株式会社|Drug carriers|

---

US20130064815A1|2011-09-12|2013-03-14|The Trustees Of Princeton University|Inducing apoptosis in quiescent cells|US9572886B2|2005-12-22|2017-02-21|Nitto Denko Corporation|Agent for treating myelofibrosis|

---

JP2009221164A|2008-03-17|2009-10-01|Nitto Denko Corp|Drug for treating pulmonary fibrosis|

---

JP5950428B2|2010-08-05|2016-07-13|日東電工株式会社|Composition for regenerating normal tissue from fibrotic tissue|

---

JP6340162B2|2012-12-20|2018-06-06|日東電工株式会社|Apoptosis inducer|

---

WO2015152332A1|2014-04-02|2015-10-08|日東電工株式会社|Targeting molecule and utilization thereof|

---

JP6480467B2|2014-04-07|2019-03-13|日東電工株式会社|Novel polymer based hydrotrope for hydrophobic drug delivery|

---

EP3159009B1|2014-06-17|2021-10-27|Nitto Denko Corporation|Inhibitors of gst-pi and rb1cc1 for use in the treatment of cancer|

---

US20160187319A1|2014-12-26|2016-06-30|Nitto Denko Corporation|Cell death-inducing agent, cell growth-inhibiting agent, and pharmaceutical composition for treatment of disease caused by abnormal cell growth|

---

US10264976B2|2014-12-26|2019-04-23|The University Of Akron|Biocompatible flavonoid compounds for organelle and cell imaging|

---

ES2789049T3|2014-12-26|2020-10-23|Nitto Denko Corp|RNA Interference Agents for GST-pi Gene Modulation|

---

US11045488B2|2014-12-26|2021-06-29|Nitto Denko Corporation|RNA interference agents for GST-π gene modulation|

---

WO2016104588A1|2014-12-26|2016-06-30|日東電工株式会社|Cell death-inducing agent, cytostatic agent, and pharmaceutical composition for treatment of diseases caused by abnormal cell growth|

---

TWI715594B|2015-06-24|2021-01-11|日商日東電工股份有限公司|Rna interference agnets for gst-pi gene modulation|

---

US10792299B2|2014-12-26|2020-10-06|Nitto Denko Corporation|Methods and compositions for treating malignant tumors associated with kras mutation|

---

JP6864990B2|2015-04-16|2021-04-28|日東電工株式会社|A cell death inducer for cells having a BRAF gene mutation, a growth inhibitor of the cells, and a pharmaceutical composition for treating a disease caused by abnormal growth of the cells.|

---

WO2016167340A1|2015-04-16|2016-10-20|日東電工株式会社|Cell death inducing agent for cells having braf gene mutation, agent for inhibiting proliferation of said cells and pharmaceutical composition for treating patient suffering from effects of abnormal proliferation of said cells|

---

JP6457704B2|2015-12-13|2019-01-23|日東電工株式会社|SiRNA structure for high activity and off-target reduction|

---

JP6899201B2|2016-06-23|2021-07-07|日東電工株式会社|Cell death inducer, cell proliferation inhibitor and therapeutic pharmaceutical composition for diseases caused by abnormal cell proliferation|

---

CN107338223B|2017-05-27|2021-01-26|温州医科大学|Method for inhibiting apoptosis of photoreceptor cells and application of SCF overexpression virus in preparation of drugs for inhibiting apoptosis of photoreceptor cells|

---

JP6952594B2|2017-12-15|2021-10-20|洋司郎 新津|Cell proliferation inhibitor and pharmaceutical composition for treating or preventing cancer containing it|

法律状态:
2018-03-13| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|

---

2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-02-18| B07E| Notice of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2020-08-25| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-02-02| B09A| Decision: intention to grant|

---

2021-04-13| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 21/06/2011, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

PCT/JP2011/064163|WO2012176282A1|2011-06-21|2011-06-21|Apoptosis-inducing agent|

---